Review



pegfp n1flag  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pegfp n1flag
    Pegfp N1flag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfp+n1flag/pm41671376-293-21-24?v=Addgene+inc
    Average 93 stars, based on 46 article reviews
    pegfp n1flag - by Bioz Stars, 2026-07
    93/100 stars

    Images



    Similar Products

    99
    TaKaRa xhoi rv aaacacctcgagtttcttcttcggttgttgag pegfp n1flag bamhi fw aaaattggatccaccggtcgccaccatgg pegfp n1
    Xhoi Rv Aaacacctcgagtttcttcttcggttgttgag Pegfp N1flag Bamhi Fw Aaaattggatccaccggtcgccaccatgg Pegfp N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfp+n1flag/pmc06889141__SC___010___C9SC02550B___s001-456-52-58?v=TaKaRa
    Average 99 stars, based on 1 article reviews
    xhoi rv aaacacctcgagtttcttcttcggttgttgag pegfp n1flag bamhi fw aaaattggatccaccggtcgccaccatgg pegfp n1 - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    93
    Addgene inc pegfp n1flag
    Pegfp N1flag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfp+n1flag/pm41671376-293-21-24?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    pegfp n1flag - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc control pegfp n1flag plasmid
    Control Pegfp N1flag Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfp+n1flag/10__1074_slash_jbc__ra119__009409-214-28-21?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    control pegfp n1flag plasmid - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results